View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13823_high_37 (Length: 205)

Name: NF13823_high_37
Description: NF13823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13823_high_37
NF13823_high_37
[»] chr6 (5 HSPs)
chr6 (8-189)||(1236389-1236570)
chr6 (22-84)||(1183182-1183244)
chr6 (99-189)||(1183239-1183328)
chr6 (49-106)||(1194054-1194111)
chr6 (145-189)||(1194126-1194170)
[»] scaffold0302 (1 HSPs)
scaffold0302 (23-182)||(20346-20509)


Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 5)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 8 - 189
Target Start/End: Complemental strand, 1236570 - 1236389
Alignment:
8 gaaggagcacagatggatgacaattgaatatctaggttttgatgtagataatgcaggtctgcaaagttctgtttttgtagctgttgcactctttttgcga 107  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1236570 gaaggatcacagatggatgacaattgaatatctaggttttgatgtagataatgcaggtctgcaaagttctgtttttgtagctgttgcactctttttgcga 1236471  T
108 gctttgtgttgctgttgggtgtgtttttagtgtgtaggggagttttccttctggcggtcctaagcagtttgctggttgcagc 189  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||    
1236470 gctttgtgttgctgttgggtgtgtttttagtgtgtcggggagttttccttctggcggtcctatgcagtttgctggttgcagc 1236389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 22 - 84
Target Start/End: Original strand, 1183182 - 1183244
Alignment:
22 ggatgacaattgaatatctaggttttgatgtagataatgcaggtctgcaaagttctgtttttg 84  Q
    ||||| |||| |||||||||||||||||| ||||||||| |||||||| ||||||||||||||    
1183182 ggatggcaatagaatatctaggttttgatatagataatgtaggtctgctaagttctgtttttg 1183244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 99 - 189
Target Start/End: Original strand, 1183239 - 1183328
Alignment:
99 tttttgcgagctttgtgttgctgttgggtgtgtttttagtgtgtaggggagttttccttctggcggtcctaagcagtttgctggttgcagc 189  Q
    |||||||| ||||  |||||||||||  ||||||||||||||  |||| |||||||||||||| ||||||| |||||||||||| ||||||    
1183239 tttttgcgcgcttcatgttgctgttgaatgtgtttttagtgtcgaggg-agttttccttctggtggtcctatgcagtttgctggctgcagc 1183328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 106
Target Start/End: Original strand, 1194054 - 1194111
Alignment:
49 atgtagataatgcaggtctgcaaagttctgtttttgtagctgttgcactctttttgcg 106  Q
    ||||||||||||||| |||||  |||||| ||||||||||||||||| | ||||||||    
1194054 atgtagataatgcagttctgccgagttctatttttgtagctgttgcagtatttttgcg 1194111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 189
Target Start/End: Original strand, 1194126 - 1194170
Alignment:
145 gggagttttccttctggcggtcctaagcagtttgctggttgcagc 189  Q
    |||| |||||||||||| ||||||| |||||||||||| ||||||    
1194126 gggatttttccttctggtggtcctatgcagtttgctggctgcagc 1194170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0302 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: scaffold0302
Description:

Target: scaffold0302; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 23 - 182
Target Start/End: Original strand, 20346 - 20509
Alignment:
23 gatgacaattgaatatctaggttttgatgtagataatgcaggtctgcaaagttctgtttt----tgtagctgttgcactctttttgcgagctttgtgttg 118  Q
    |||| |||| ||||||||||||||  |||| ||||||||||||||||  |||||||||||    |||| ||||||| || |||||| | |||| ||||||    
20346 gatggcaatagaatatctaggtttcaatgtggataatgcaggtctgccgagttctgttttattttgtacctgttgcgctatttttgtgtgcttcgtgttg 20445  T
119 ctgttgggtgtgtttttagtgtgtaggggagttttccttctggcggtcctaagcagtttgctgg 182  Q
     ||||||||||||||||||||||  ||||| |||||||||||| |||||||  |||||||||||    
20446 ttgttgggtgtgtttttagtgtgctggggatttttccttctggtggtcctatacagtttgctgg 20509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University