View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13823_low_28 (Length: 275)

Name: NF13823_low_28
Description: NF13823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13823_low_28
NF13823_low_28
[»] chr8 (1 HSPs)
chr8 (21-263)||(41077129-41077371)


Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 21 - 263
Target Start/End: Complemental strand, 41077371 - 41077129
Alignment:
21 ggagtagggaggaggaggaggtgttccgttacctttggaagagctcggcaccatcaaaggtattagctttttcttggactttgcttcttgaccgtattcc 120  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
41077371 ggagtagggaggaggaggaggtgttccgttacctttggaagagctcggcaccatcaaaggtattagttttttcttggactttgcttcttgaccgtattcc 41077272  T
121 gacaaaagctaatcttgataagaggcggatgttggatgaggatgtctcaaggtgttgttgtttttgcgataatgagggtgaaacatcaatccatctcttt 220  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41077271 gacaaaagctaatcttgataagaggcggatgttggatgaggatgtctcaaggtgttgttgtttttgcgataatgagggtgaaacatcaatccatctcttt 41077172  T
221 ttgcattgtgatgtggtttgtaaggtgtggttaagggtgatga 263  Q
    |||||||||||||||||||||||||||||||||||||||||||    
41077171 ttgcattgtgatgtggtttgtaaggtgtggttaagggtgatga 41077129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University