View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13823_low_32 (Length: 247)
Name: NF13823_low_32
Description: NF13823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13823_low_32 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 20 - 247
Target Start/End: Original strand, 42548603 - 42548830
Alignment:
| Q |
20 |
atctttaacagtggatctcttcaaagaaatagtgacgatatcatcatcaatagtggatcttttcgaaaaaattattctggaaagcttacatttagagtct |
119 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42548603 |
atctttaatagtggatctcttcgaagaaatagtgacgatatcatcatcaatagtggatctcttcgaaaaaattattctggaaagcttacatttagagtct |
42548702 |
T |
|
| Q |
120 |
tcatcacttgttttaccgctacttttggaggtctaattttcggctatgatattggcatctcaggtatacattcaatctctttttacattcttttttcttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42548703 |
tcatcacttgttttaccgctacttttggaggtctaattttcggctatgatattggcatctcaggtatacattcaatctctttttacattcttttttcttt |
42548802 |
T |
|
| Q |
220 |
gatgaaatcaaactccagggtttatatt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
42548803 |
gatgaaatcaaactccagggtttatatt |
42548830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 141 - 189
Target Start/End: Complemental strand, 18235767 - 18235719
Alignment:
| Q |
141 |
cttttggaggtctaattttcggctatgatattggcatctcaggtataca |
189 |
Q |
| |
|
|||| |||||| ||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
18235767 |
ctttcggaggtttaatttttggctatgaccttggcatctcaggtataca |
18235719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University