View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13823_low_35 (Length: 232)
Name: NF13823_low_35
Description: NF13823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13823_low_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 14 - 192
Target Start/End: Original strand, 6261185 - 6261361
Alignment:
| Q |
14 |
aagaatataattgtttttctttatgtaccactttgctatagaaaactgatgaagacataaagaggttctattttttgttgaattacggtaggtgtatttg |
113 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6261185 |
aagaaaataattgtttttctttatgtaccactttgctatagaaaactgatgaagacaaaaag--gttctattttttgttgaattatggtaggtgtatttg |
6261282 |
T |
|
| Q |
114 |
caaatataccactttgctttatattgtttatcagtcacgcatcttagaagagaggtgaggaactttaagtgtaactaag |
192 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6261283 |
caaatataccactttgctatatattgtttatcagtcacacatcgtagaagagaggtgaggaactttaagtgtaactaag |
6261361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University