View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13823_low_41 (Length: 205)
Name: NF13823_low_41
Description: NF13823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13823_low_41 |
 | |
|
| [»] scaffold0302 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 8 - 189
Target Start/End: Complemental strand, 1236570 - 1236389
Alignment:
| Q |
8 |
gaaggagcacagatggatgacaattgaatatctaggttttgatgtagataatgcaggtctgcaaagttctgtttttgtagctgttgcactctttttgcga |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1236570 |
gaaggatcacagatggatgacaattgaatatctaggttttgatgtagataatgcaggtctgcaaagttctgtttttgtagctgttgcactctttttgcga |
1236471 |
T |
|
| Q |
108 |
gctttgtgttgctgttgggtgtgtttttagtgtgtaggggagttttccttctggcggtcctaagcagtttgctggttgcagc |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1236470 |
gctttgtgttgctgttgggtgtgtttttagtgtgtcggggagttttccttctggcggtcctatgcagtttgctggttgcagc |
1236389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 22 - 84
Target Start/End: Original strand, 1183182 - 1183244
Alignment:
| Q |
22 |
ggatgacaattgaatatctaggttttgatgtagataatgcaggtctgcaaagttctgtttttg |
84 |
Q |
| |
|
||||| |||| |||||||||||||||||| ||||||||| |||||||| |||||||||||||| |
|
|
| T |
1183182 |
ggatggcaatagaatatctaggttttgatatagataatgtaggtctgctaagttctgtttttg |
1183244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 99 - 189
Target Start/End: Original strand, 1183239 - 1183328
Alignment:
| Q |
99 |
tttttgcgagctttgtgttgctgttgggtgtgtttttagtgtgtaggggagttttccttctggcggtcctaagcagtttgctggttgcagc |
189 |
Q |
| |
|
|||||||| |||| ||||||||||| |||||||||||||| |||| |||||||||||||| ||||||| |||||||||||| |||||| |
|
|
| T |
1183239 |
tttttgcgcgcttcatgttgctgttgaatgtgtttttagtgtcgaggg-agttttccttctggtggtcctatgcagtttgctggctgcagc |
1183328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 106
Target Start/End: Original strand, 1194054 - 1194111
Alignment:
| Q |
49 |
atgtagataatgcaggtctgcaaagttctgtttttgtagctgttgcactctttttgcg |
106 |
Q |
| |
|
||||||||||||||| ||||| |||||| ||||||||||||||||| | |||||||| |
|
|
| T |
1194054 |
atgtagataatgcagttctgccgagttctatttttgtagctgttgcagtatttttgcg |
1194111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 189
Target Start/End: Original strand, 1194126 - 1194170
Alignment:
| Q |
145 |
gggagttttccttctggcggtcctaagcagtttgctggttgcagc |
189 |
Q |
| |
|
|||| |||||||||||| ||||||| |||||||||||| |||||| |
|
|
| T |
1194126 |
gggatttttccttctggtggtcctatgcagtttgctggctgcagc |
1194170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0302 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: scaffold0302
Description:
Target: scaffold0302; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 23 - 182
Target Start/End: Original strand, 20346 - 20509
Alignment:
| Q |
23 |
gatgacaattgaatatctaggttttgatgtagataatgcaggtctgcaaagttctgtttt----tgtagctgttgcactctttttgcgagctttgtgttg |
118 |
Q |
| |
|
|||| |||| |||||||||||||| |||| |||||||||||||||| ||||||||||| |||| ||||||| || |||||| | |||| |||||| |
|
|
| T |
20346 |
gatggcaatagaatatctaggtttcaatgtggataatgcaggtctgccgagttctgttttattttgtacctgttgcgctatttttgtgtgcttcgtgttg |
20445 |
T |
|
| Q |
119 |
ctgttgggtgtgtttttagtgtgtaggggagttttccttctggcggtcctaagcagtttgctgg |
182 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||| ||||||| ||||||||||| |
|
|
| T |
20446 |
ttgttgggtgtgtttttagtgtgctggggatttttccttctggtggtcctatacagtttgctgg |
20509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University