View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13825_low_15 (Length: 214)
Name: NF13825_low_15
Description: NF13825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13825_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 183
Target Start/End: Original strand, 40257844 - 40258022
Alignment:
| Q |
1 |
acatatttttatttgacaacgaaaattggtgattcactacaggaaaacttaggaaagcatgttaagcaacacaatattgctaacaaaaatcacacatgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40257844 |
acatatttttatttgacaacgaaaattggtgattcagtacaggaaaacttacgaaagcatgttaagcaacacaatattgctaacaaaaatcacacatgca |
40257943 |
T |
|
| Q |
101 |
gataaagcaaagcatcatctaataatgggtagtcactataattaatatctaggtttgcaacacacaagtgtttttgaattggg |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40257944 |
gataaagcaaagcatcatctaataatgggtagtcacta----taatatctaggtttgcaacacacaagtgtttttgaattggg |
40258022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 54 - 90
Target Start/End: Original strand, 4665975 - 4666011
Alignment:
| Q |
54 |
aaagcatgttaagcaacacaatattgctaacaaaaat |
90 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4665975 |
aaagcatgttaaccaacacaatattgctaacaaaaat |
4666011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University