View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13826_high_14 (Length: 270)
Name: NF13826_high_14
Description: NF13826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13826_high_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 10 - 232
Target Start/End: Complemental strand, 35255321 - 35255110
Alignment:
| Q |
10 |
aagaatattacgggtaggtgcaattttagcatatcttgtgatttaaactatgattcatataaatcttttatgctcaataatttatttggcttatcaaaaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35255321 |
aagaatattacgggtaggtgcaattttagcatatcttgtgatttaaactatgattcatataaatcttttatgctcaataatttatttggcttatcaaaaa |
35255222 |
T |
|
| Q |
110 |
atgaaagatttttctaataaaaacaagttacaacatgtgtgagcggaaggtcaaaccttctatgtcaactaccttagatgtaacaatgaaattaatcatg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35255221 |
atgaaagatttttctaataaaaacaagttacaacatgtgtgagcggaaggtcgaaccttctatgtcaactaccttagat-----------attaatcatg |
35255133 |
T |
|
| Q |
210 |
aaacataattgattgataacttt |
232 |
Q |
| |
|
|||||||| |||||||||||||| |
|
|
| T |
35255132 |
aaacataagtgattgataacttt |
35255110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University