View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13826_high_17 (Length: 228)
Name: NF13826_high_17
Description: NF13826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13826_high_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 17 - 210
Target Start/End: Original strand, 40839060 - 40839253
Alignment:
| Q |
17 |
aatatttgttgtataagaacaatcacacctaaaccacaatttaaaaccatgattgagtagtcaacatagtagcatagaagaaaaaggattgttaccgatc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40839060 |
aatatttgttgtataagaacaatcacacctaaaccacaatttaaaaccatgattgagtagtcaacatagtagcatagaagaaaaaggattgttaccgatc |
40839159 |
T |
|
| Q |
117 |
gaaggaaactcagtttctgtccccggctgcgaccatcgggggaagtcaagtctatagtctcagtgctatctacattgtgaagagttgttggatg |
210 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40839160 |
gaaggaaactcagcttctgtccccggctgcgaccatcggttgaagtcaagtctatagtctcagtgctatctacattgtgaagagttgttggatg |
40839253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University