View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13826_low_13 (Length: 272)
Name: NF13826_low_13
Description: NF13826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13826_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 18 - 264
Target Start/End: Original strand, 27027732 - 27027978
Alignment:
| Q |
18 |
ttcccatcctcagacctggcaattttgctggacaaaatgttcccatatttttgaaataaatcatgtagtcccacattatctatggatgctgctaagttct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27027732 |
ttcccatcctcagacctggcaattttgctggacaaaatgttcccatatttttgaaataaatcatgtagtcccacattatctatggatgctgctaagttct |
27027831 |
T |
|
| Q |
118 |
gtatattgacaccagaaagttttcattagaattcacttcatacataaaaatgaatcggaatatcatcatttaagcatttcgcatcaaagcaagatagtgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27027832 |
gtatattgacaccagaaagttttcattagaattcacttcatacataaaaatgaatcggaatatcatcatttaagcatttcgcatcaaagcaagatagtgt |
27027931 |
T |
|
| Q |
218 |
aataatgtataacatataccttaacaaacacattccctttgctactc |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27027932 |
aataatgtataacatataccttaacaaacacattccctttgccactc |
27027978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University