View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13826_low_16 (Length: 235)
Name: NF13826_low_16
Description: NF13826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13826_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 20 - 218
Target Start/End: Complemental strand, 35821694 - 35821496
Alignment:
| Q |
20 |
gaagaccgaaacataaacataattggaaactagaaaagggaaaccatgnnnnnnngatgaagaccgaagtaaaggaagacatgcatatgtcgaaactttt |
119 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35821694 |
gaagagcgaaacataaacataattggaaactagaaaagggaaaccatgaaaaaaagatgaagaccgaagtaaaggaagacatgcatatgtcgaaactttt |
35821595 |
T |
 |
| Q |
120 |
tgaatccctatctattctcattgtagctgcaactgtctgaacaatgaagatataccatagtaagaatttgttttttggacatttgtctgagcatgatct |
218 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35821594 |
tgaatccctatctattctcactgtagctgcgactgtctgaacaatgaagatataccatagtgggaatttgttttttggacatttgtctgagcatgatct |
35821496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University