View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13827_low_13 (Length: 321)
Name: NF13827_low_13
Description: NF13827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13827_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 18 - 317
Target Start/End: Original strand, 3106157 - 3106456
Alignment:
| Q |
18 |
gaaaatagataaatagcgtcttcatgacgattctgcttagaaaaacttgtaattatttcggtggctaatctaacagttaataagtcgggcatttcatcaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| |||||||||||| |||||||||||||||| |
|
|
| T |
3106157 |
gaaaatagataaatagcgtcttcatgacgactctgcttagaaaaacttgtaattatttcggtgactaatccaacagttaataattcgggcatttcatcaa |
3106256 |
T |
|
| Q |
118 |
acatgttgcaggcaacatcgaaagtgattgaatcagaaccatttggttcaaacccagtatgtaaaaaattggttttatcatgggaatgatgggttttggt |
217 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3106257 |
acatgttgcaggcaacatcgaaagtaattgaatcagaaccatttggttgaaacccagtatgtaaaaaattggttttatcatgggaatgatgggttttggt |
3106356 |
T |
|
| Q |
218 |
ttgataggagcaaaaaggaaaatggggtgtggaaaatctagaaattatgttttttatgggagtttttgtgtgttgttggattgatgttttcatatcactc |
317 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3106357 |
ttgataggtgcaaaaaggaaaatggggtgtggaaaatctagaaattatgttttttatgggagtttttgtgtggtgttggattgatgttttcatatcactc |
3106456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University