View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13828_low_7 (Length: 373)
Name: NF13828_low_7
Description: NF13828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13828_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 91; Significance: 5e-44; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 271 - 361
Target Start/End: Original strand, 22665484 - 22665574
Alignment:
| Q |
271 |
tatacaccctacacaaaacatttccctaaatgaaattacatgattgaacatgcgtttgcattgtcatcattaaaaagtgccatcatcttca |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22665484 |
tatacaccctacacaaaacatttccctaaatgaaattacatgattgaacatgcgtttgcattgtcatcattaaaaagtgccatcatcttca |
22665574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 93 - 184
Target Start/End: Original strand, 22665309 - 22665400
Alignment:
| Q |
93 |
aaagcaacataatatgatatttatccaaagaattgatggttgaaactgacaaagaaaacaaacgctataaattttacaaatcaattcaacac |
184 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22665309 |
aaagcaatataatatgatatttatccaaagaattgatggttgaaactgacaaagaaaacaaacgctataaattttacaaatcaattcaacac |
22665400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University