View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13829_low_3 (Length: 420)
Name: NF13829_low_3
Description: NF13829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13829_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 351; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 351; E-Value: 0
Query Start/End: Original strand, 16 - 402
Target Start/End: Complemental strand, 38748686 - 38748300
Alignment:
| Q |
16 |
aacatttccacccctcatacttttattattatttgcacccccatttcacaatgactactatttgtgctgaacaacaccaacaacgcaagtttcattcttc |
115 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38748686 |
aacatttccacacctcatactcttattattatttgcaccctcatttcacaatgactactatttgtgctgaacaacaccaacaacacaagtttcattcttc |
38748587 |
T |
|
| Q |
116 |
ctaccaacctctctctcccaaaaaatcccttagagacattgacattcctccaagaaagctcctcacccgccgcaacaccaccgccgccgtcgacatcttc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38748586 |
ctaccaacctctctctcccaaaaaatcccttagagacattgacatccctccaagaaagctcctcacccgccgcaacaccaccgctgccgtcgacatcttc |
38748487 |
T |
|
| Q |
216 |
tccgacgacaccatcctccagaaattcctcccacacaatgactctgactcagactccgacgatccttactcttctgaccattttcgcatgtatgaattca |
315 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38748486 |
tccgacgacaccatcctccaaaaattcctcccacacaatgactctgactcagactccgacgatccttactcttccgaccattttcgcatgtatgaattca |
38748387 |
T |
|
| Q |
316 |
aagtccgccgctgcactcgtagccggagccacgactggactgactgtccatttgctcaccccggtgagaaagctcgccgccgtgatc |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38748386 |
aagtccgccgctgcactcgtagccggagccacgactggactgactgtccattcgctcaccccggtgagaaagctcgccgccgtgatc |
38748300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 303 - 361
Target Start/End: Original strand, 30385537 - 30385595
Alignment:
| Q |
303 |
atgtatgaattcaaagtccgccgctgcactcgtagccggagccacgactggactgactg |
361 |
Q |
| |
|
||||| || |||||| |||| || ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30385537 |
atgtacgagttcaaaatccggcgatgcacccgtagccggagccacgactggactgactg |
30385595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 348 - 400
Target Start/End: Complemental strand, 42926378 - 42926326
Alignment:
| Q |
348 |
gactggactgactgtccatttgctcaccccggtgagaaagctcgccgccgtga |
400 |
Q |
| |
|
|||||||| || ||||| ||| |||| ||||| |||||||||||||||||||| |
|
|
| T |
42926378 |
gactggacggagtgtcctttttctcatcccggcgagaaagctcgccgccgtga |
42926326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University