View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1382_low_11 (Length: 325)
Name: NF1382_low_11
Description: NF1382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1382_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 3e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 52 - 209
Target Start/End: Original strand, 12274111 - 12274267
Alignment:
| Q |
52 |
ttgttgtgtttcacagagatgaatgacacactctctttcgtgttaacagaggaacatttgagcgaaagaagcgatggttggtgtaactaggactttt-gg |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
12274111 |
ttgttgtgtttcacagagatgaatgacacactct--ttcgtgttaacagaggaacatttgagcgaaagaagcgatggttggtgtaactaggacttttggg |
12274208 |
T |
 |
| Q |
151 |
agactattgtcaaccgcctgcatagaatgttcaagtccttttccgtgttttctactttc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12274209 |
agactattgtcaaccgcctgcatagaatgttcaagtccttttccgtgttttctactttc |
12274267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University