View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1382_low_14 (Length: 302)
Name: NF1382_low_14
Description: NF1382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1382_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 29 - 293
Target Start/End: Original strand, 32998065 - 32998329
Alignment:
| Q |
29 |
aaattcattacttgaaatagaaaatatgaagagagagtaaccgaaccgaaatgagaaggagaggtcgaagggaagagccttgacgagaccaacgaagaac |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32998065 |
aaattcattacttgaaatagaaaatatgaagagagagtaaccgaaccgaaatgagaaggagaggtcgaagggaagagccttgacgagaccaacgaagaac |
32998164 |
T |
|
| Q |
129 |
acggcgagtgtagtttctagaagcttcgggaatgtaaggagagagcgaggttttgattcgatttgcagtatcacaaggttctaatatcaaactctgaacg |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32998165 |
acggcgagtgtagtttctagaagcttcgggaatgtaaggagagagtgaggttttgattcgatttgcagtatcacaaggttctaatatcaaactctgaacg |
32998264 |
T |
|
| Q |
229 |
acgtcgtatatcttctttttgttgaagctctcttgttctactgtaactccgttttccttctctgc |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32998265 |
acgtcgtatatcttctttttgttgaagctctcttgttctactgtaactccgttttccttctctgc |
32998329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University