View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1382_low_20 (Length: 259)

Name: NF1382_low_20
Description: NF1382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1382_low_20
NF1382_low_20
[»] chr4 (1 HSPs)
chr4 (1-60)||(37975405-37975464)


Alignment Details
Target: chr4 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 37975405 - 37975464
Alignment:
1 tcaggttatggtcatggtggtggttttgtcgatcagtactcaaatttaaatgggacaact 60  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37975405 tcaggttatggtcatggtggtggttttgtcgatcagtactcaaatttaaatgggacaact 37975464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University