View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13830_high_15 (Length: 207)
Name: NF13830_high_15
Description: NF13830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13830_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 15 - 191
Target Start/End: Complemental strand, 14012582 - 14012399
Alignment:
| Q |
15 |
agaatatgtgcataatgtatggttctgaat-------gaaggtcaactaaaagatgcaaaggaagaaactaagaagaggagggaccggttatagattcgg |
107 |
Q |
| |
|
|||| |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14012582 |
agaaaatgtgcataacgtatggttctgaattctccatgaaggtcaactaaaagatgcaaaggaagaaactaagaagaggagggaccggttatagattcgg |
14012483 |
T |
 |
| Q |
108 |
ttggattacaaactttttccaaagcaaaattgatgattcgaaagagaaaagtttccaatgaaattggttttgtcaccttacatt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14012482 |
ttggattacaaactttttccaaagcaaaattgatgattcgaaagagaaaagtttccaatgaatttggttttgtcaccttacatt |
14012399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University