View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13830_high_15 (Length: 207)

Name: NF13830_high_15
Description: NF13830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13830_high_15
NF13830_high_15
[»] chr5 (1 HSPs)
chr5 (15-191)||(14012399-14012582)


Alignment Details
Target: chr5 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 15 - 191
Target Start/End: Complemental strand, 14012582 - 14012399
Alignment:
15 agaatatgtgcataatgtatggttctgaat-------gaaggtcaactaaaagatgcaaaggaagaaactaagaagaggagggaccggttatagattcgg 107  Q
    |||| |||||||||| ||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14012582 agaaaatgtgcataacgtatggttctgaattctccatgaaggtcaactaaaagatgcaaaggaagaaactaagaagaggagggaccggttatagattcgg 14012483  T
108 ttggattacaaactttttccaaagcaaaattgatgattcgaaagagaaaagtttccaatgaaattggttttgtcaccttacatt 191  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
14012482 ttggattacaaactttttccaaagcaaaattgatgattcgaaagagaaaagtttccaatgaatttggttttgtcaccttacatt 14012399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University