View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13830_low_11 (Length: 272)
Name: NF13830_low_11
Description: NF13830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13830_low_11 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 272
Target Start/End: Original strand, 26776050 - 26776321
Alignment:
| Q |
1 |
aaattgtttgaatatgcattggccaattagcctgacgatgttgtggatcgatgggagaagattgcggccggtgtgcctgggaaatctttggaacaaatta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26776050 |
aaattgtttgaatatgcattggccaattatcctgacgatgttgtggatcgatgggagaagattgcggccggtgtgcctgggaaaactttggaacaaatta |
26776149 |
T |
|
| Q |
101 |
aacatcactatgaggttttgatagatgatatccacaacattgaatctggttttgtgcctccaccagattatgattctttttcaaactcaacaaagtgtac |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26776150 |
aacatcactatgaggttttggtagatgatattcacaacattgaatctggttttgtgcctctaccagattatgattctttttcaaactcaacaaagtgtac |
26776249 |
T |
|
| Q |
201 |
tattgtcaaaaagggaattaaggcttccggttcttatcattggacagaagatgaacacaggtctgtttatct |
272 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26776250 |
tattgttaaaaagggaactaaggcttccggttcttatcattggacagaagatgaacacaggtctgtttatct |
26776321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 7 - 185
Target Start/End: Complemental strand, 26556619 - 26556441
Alignment:
| Q |
7 |
tttgaatatgcattggccaattagcctgacgatgttgtggatcgatgggagaagattgcggccggtgtgcctgggaaatctttggaacaaattaaacatc |
106 |
Q |
| |
|
|||||| || ||||||| ||||| || || || | |||||||||||||||||| |||||||| | |||||| |||||| |||| ||| | ||||||| || |
|
|
| T |
26556619 |
tttgaaaatacattggcgaattatcccgaggacgctgtggatcgatgggagaaaattgcggctgatgtgcccgggaaaactttagaagagattaaacgtc |
26556520 |
T |
|
| Q |
107 |
actatgaggttttgatagatgatatccacaacattgaatctggttttgtgcctccaccagattatgattctttttcaaa |
185 |
Q |
| |
|
|||||| ||||||| | ||||||||| || |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26556519 |
actatgtggttttgtttgatgatatcaaccacattgaatctggttttgtgcctctgccagattatgattctttttcaaa |
26556441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University