View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13830_low_12 (Length: 251)
Name: NF13830_low_12
Description: NF13830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13830_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 24 - 238
Target Start/End: Original strand, 37100801 - 37101015
Alignment:
| Q |
24 |
agtactactagtagtgaagtgttgtgttgtgttaattgcaggtggagacagagagagggtagataaagagttaacgtgtgtctctgcaacttaactcaga |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37100801 |
agtactactagtagtgaagtgttgtgttgtgttaattgcaggtggagacagagagagggtagataaagagttaacgtgtgtctctgcaacttaactcaga |
37100900 |
T |
 |
| Q |
124 |
gttttccttcccaatgaaatgaaaatgaatctcactgcccttcttggtctacgcaattactgctgatcattctactgtttatgagtactactaacactat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37100901 |
gttttccttcccaatgaaatgaaaatgaatctcactgcccttcttggtctacgcaattactgctgatcattctactgtttatgagtactactaacactat |
37101000 |
T |
 |
| Q |
224 |
ttgttgcctatgcta |
238 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
37101001 |
ttgttgcctatgcta |
37101015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University