View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13830_low_13 (Length: 250)
Name: NF13830_low_13
Description: NF13830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13830_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 20 - 235
Target Start/End: Complemental strand, 4961204 - 4960985
Alignment:
| Q |
20 |
tataacacgtttaagtcacgctgaaggtattggatcaattatagcccatgtacgaatacggaaactggcaggaatatgatag----gaacctgcaacgtc |
115 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
4961204 |
tataacacgtttaagtcaagccgaaggtattggatcaattatagcccatgtacgaatacggaaactggcaggaatatgatagtacggaacctgcaccgtc |
4961105 |
T |
 |
| Q |
116 |
aattttttccatctacatgtgttttcttcgctgattagtcggtgtatgtcttggattggcatttcaagtacaaattgtccattctgatatacatctatgt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4961104 |
aattttttccatctacatgtgttttcttcgttgattagtcagtgtatgtcttggattggcatttcaagtacaaattgtccattctgatatacatctatgt |
4961005 |
T |
 |
| Q |
216 |
gtttggatcttgctcctttg |
235 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
4961004 |
gtttggatcttgctcctttg |
4960985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University