View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13830_low_9 (Length: 317)
Name: NF13830_low_9
Description: NF13830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13830_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 10 - 269
Target Start/End: Original strand, 26776298 - 26776556
Alignment:
| Q |
10 |
agatgaacacaggtctgtttatctttgctttgctttgctttggaa----atttgtttttagattgttattatttacaacttacatgcatggctgttaata |
105 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| | | |||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
26776298 |
agatgaacacaggtctgtttatcttt-----gctttgctttggtaacttaattgtttttagattgttgttatttacaacttacattcatggctgttaata |
26776392 |
T |
|
| Q |
106 |
acataataatgataagatactaattaaggtgaagctttcggtcttttggtgttggctggagaccttggagtgtgctctatcaaggtcttagagactcgat |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26776393 |
acataataatgataagatactaattaaggtgaagctttcagtctttaggtgttggctggagaccttggagtgtgctctatcaaggtcttagagactcgat |
26776492 |
T |
|
| Q |
206 |
tatctcgggtgctagtttagggtttagggtttgagtttcttgaattagttttgatggactcctt |
269 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26776493 |
tatctcgattgctagtttagggtttagggtttgagtttcttgaattagttttgatggactcctt |
26776556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University