View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13831_low_13 (Length: 382)
Name: NF13831_low_13
Description: NF13831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13831_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 1 - 369
Target Start/End: Complemental strand, 49085060 - 49084692
Alignment:
| Q |
1 |
ttgctttgatcacaagtataggtggcatcatccgaccagtgatgaggttctgagttctgacttttaggattggaatgggaggaaatacttgtgggaaatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49085060 |
ttgctttgatcacaagtataggtggcatcatccgaccagtgatgaggttctgagttctggcttttaggattggaatgggaggaaatacttgtgggaaatg |
49084961 |
T |
|
| Q |
101 |
gagaactctctttttggaacactgattttggtgtccaagtgggatgcatccctgattgtgcgttgaacatagaatgtaaaacgttatcatgttccataga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49084960 |
gagaactctctttttggaacactgattttggtgtccaagtgggatgcatccctgattgtgcgttgaacatagaatgtaaaacgttattatgttccataga |
49084861 |
T |
|
| Q |
201 |
cttattgtcggaagtggcccctgtggctggaaagaattcaagttgacattttgtatcaacttgcccagactgaccaatcaccagatatgtgatattttcc |
300 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49084860 |
cttattatcggaagtggcccctgtggctggaaagaattcaagttgacattttgtatcaacttgcccagactgaccaatcaccagatatgtgatattttcc |
49084761 |
T |
|
| Q |
301 |
tgcttttgnnnnnnnccatcataatgatgagtagtgtttatattttcagataatttttgtgattcatga |
369 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49084760 |
tgcttttgtttttttccatcataatgatgagtagtgtttatattttcagataatttttgtgattcatga |
49084692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University