View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13831_low_14 (Length: 350)
Name: NF13831_low_14
Description: NF13831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13831_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 4e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 47 - 237
Target Start/End: Complemental strand, 4388161 - 4387972
Alignment:
| Q |
47 |
ttaaaattcttccgcccaccaaacacttctttgtgttttatgggtgcctcttttgttgatcctatcatctcatcaatgattgtgttgatttgtgtcgctc |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4388161 |
ttaaaattcttccgcccaccaaacacttctttgtgtgttatgggtgcctcttt-gttgatcctatcatctcatcaatgattgtgttgatttgtgtcgctc |
4388063 |
T |
 |
| Q |
147 |
tgccttcctttgtgactccaatcaaacaatttgttgaatcatggagaaagcaaaacatagtaagccgaggaacaagttctttacagaagca |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4388062 |
tgccttcctttgtgactccaatcaaacaatttgtttaatcatggagaaagcaaaacatagtaagccgaggaacaagttctttacagaagca |
4387972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University