View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13831_low_21 (Length: 249)
Name: NF13831_low_21
Description: NF13831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13831_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 18 - 193
Target Start/End: Complemental strand, 7228754 - 7228579
Alignment:
| Q |
18 |
gatagtacatagcatagaagtgccataaatcaactcaaattcaatttgggtgcttctttatcatctttatcatatatagctcggtacggtctagggtata |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7228754 |
gatagtacatagcataaaagtgccataaatcaactcaaattcaatttgggtgcttctttatcatctttatcatatatagctcggtacggtctagggtata |
7228655 |
T |
 |
| Q |
118 |
gtcctattcctttcaatcctactgcaaaagaaaggaatatatatgttaatgtaccttgtaatataccttttaaatt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7228654 |
gtcctattcctttcaatcctactgcaaaagaaaggaatatatatgttaatgtaccttgtaatatgccttttaaatt |
7228579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 212 - 249
Target Start/End: Complemental strand, 7228579 - 7228542
Alignment:
| Q |
212 |
tattgaagtttaattgaaatctcacattgattgttaat |
249 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7228579 |
tattgaagtttaattgaagtctcacattgattgttaat |
7228542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University