View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13831_low_7 (Length: 516)
Name: NF13831_low_7
Description: NF13831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13831_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-110; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-110
Query Start/End: Original strand, 182 - 392
Target Start/End: Original strand, 14754760 - 14754970
Alignment:
| Q |
182 |
cacttgtttcatcttctgtttttgtttctgtagtagctggtgcttcttccactttctcttctgtgactatgaaagttgataccttctcaaaaacaaagaa |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14754760 |
cacttgtttcatcttctgtttttgtttctgtagtagctggtgcttcttcaactttctcttctgtgactatgaaagttgataccttctcaaaaacaaagaa |
14754859 |
T |
|
| Q |
282 |
aactggacctgaaactaaggctggtccaaacttggatgatgcttcagatactgcttttgatccaggaaaatctgaaatatatatactcactagtatcaat |
381 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14754860 |
aactggacctgaaactaaggctggtccaaacttggatgatgcttcagatactgcttttgatccaggaaaatctgaaatatatatactcacttgtatcaat |
14754959 |
T |
|
| Q |
382 |
atatttttctt |
392 |
Q |
| |
|
||||||||||| |
|
|
| T |
14754960 |
atatttttctt |
14754970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 19 - 89
Target Start/End: Original strand, 14754597 - 14754667
Alignment:
| Q |
19 |
tcaaccgcagctggttcaaccggtttttcctcctgtttctcggcaggaggaggagtcggctcagctgcatc |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14754597 |
tcaaccgcagctggttcaaccggtttttcctcctgtttctcggcaggaggaggagtcggctcagctgcatc |
14754667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 463 - 516
Target Start/End: Original strand, 14755041 - 14755094
Alignment:
| Q |
463 |
actttaccaattttaacaagttcttctatgaatttgtgaacttctgttgagttc |
516 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14755041 |
actttaccaattttaacaagttcttctatgaatttgtgaacttctgttgagttc |
14755094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University