View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13832_low_13 (Length: 203)
Name: NF13832_low_13
Description: NF13832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13832_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 64 - 202
Target Start/End: Complemental strand, 14486020 - 14485882
Alignment:
| Q |
64 |
aaaacacttctacaattcccttaaaaaagatcactgtagaaagaaaaaattacactaacaaatgacctacaattaaagtagaatattatattgctaataa |
163 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| ||||||||||||||||||| |
|
|
| T |
14486020 |
aaaacagttctacaattcccttaaaaaagatcactgtagaaagaaaaaattacactaacaaatgatctaaaattaaagtacaatattatattgctaataa |
14485921 |
T |
 |
| Q |
164 |
agtttttactagggagtggcccgcttaagatgcattcat |
202 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
14485920 |
agtttttactatggagtggcccgcttaagatgcattcat |
14485882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 40257655 - 40257598
Alignment:
| Q |
1 |
tatatagtcgttatgtatttattctataagaaatgagctcaaataaatgagcgtgcaa |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40257655 |
tatatagtcgttatgtatttattctataagaaatgagctcaaataaatgagcgtgcaa |
40257598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University