View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13832_low_8 (Length: 391)
Name: NF13832_low_8
Description: NF13832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13832_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 7e-62; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 245 - 373
Target Start/End: Complemental strand, 34811624 - 34811497
Alignment:
| Q |
245 |
acaaaaagttgttatatattataatatacaatatttgtcgaatctagacccatacttggaagtattttcctttgaaaaaatgtgtatttcagaaactaag |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34811624 |
acaaaaagttgttatatattataatatacaatatttgtcgaatctagacccatacttggaagtattttcctttgaaaaaatgtgtatttcagaaactaag |
34811525 |
T |
|
| Q |
345 |
gtggggggaatgaatgtggatggattctg |
373 |
Q |
| |
|
||| ||||||||||||||||||||||||| |
|
|
| T |
34811524 |
gtg-ggggaatgaatgtggatggattctg |
34811497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 34811882 - 34811800
Alignment:
| Q |
1 |
agatgaaaaacaacgattgttcacgggagtctggagaaa----------acatacattacatcatgatttcaaatttggatag |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34811882 |
agatgaaaaacaacgattgttcacgggagtctggagaaaacatgtgaccacatacattacatcatgatttcaaatttggatag |
34811800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 140 - 182
Target Start/End: Complemental strand, 34811728 - 34811686
Alignment:
| Q |
140 |
gaaagaataatttatacaataattttagttttcttttacatgc |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34811728 |
gaaagaataatttatacaataattttagttttcttttacatgc |
34811686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University