View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13832_low_9 (Length: 362)
Name: NF13832_low_9
Description: NF13832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13832_low_9 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 16 - 362
Target Start/End: Original strand, 39991284 - 39991630
Alignment:
| Q |
16 |
atcgtgggttgtgactatctttgcagtttggtgcggttggtgttggaattctaacaagggtgcatgtggggttatctttggatcctttgttccttgaagg |
115 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39991284 |
atcgtgggttgtgactctctctgcagtttggtgcggttggtgttggaattctaacaagggtgcatgtggggttatctttggatcctttgttccttgaagg |
39991383 |
T |
|
| Q |
116 |
gtttactttggtaacctttgattgtgattgtttcaggttgttgagaaattgtgcctcatcatctttgacttaacaagactattttttctgttggagattt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39991384 |
gtttactttggtaacctttgattgtgattgtttcaggttgttgagaaattgtgcctcatcatctttgacttaacaagactattttttctgttggagattt |
39991483 |
T |
|
| Q |
216 |
tgttgttttaggtgttattgttgcaaaagaaatgcagaaagaaaaggtataatttttgttcaattaatgtttataatttccatttccaaaccctatnnnn |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39991484 |
tgttgttttaggtgttattgttgcaaaagaaatgcagaaagaaaaggtataatttttgttcaattaatgtttataatttccatttccaaaccctataaaa |
39991583 |
T |
|
| Q |
316 |
nnnntcattgcttttgcagagttcttttctcatataagtgaattatg |
362 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39991584 |
aaaatcattgcttttgcagagttcttttctcatatgagtgaattatg |
39991630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University