View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13833_high_5 (Length: 325)
Name: NF13833_high_5
Description: NF13833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13833_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 19 - 315
Target Start/End: Complemental strand, 11001081 - 11000785
Alignment:
| Q |
19 |
gttccagtctcgggagtcattccttcagtgtgcacctcaatccgagccactccaaagtcagcaattttgattgacttgtcaccaaaaatcaataggttgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11001081 |
gttccagtctcgggagtcattccttcagtgtgcacctcaatccgagccactccaaagtcagcaattttgattgacttgtcaccaaaaatcaataggttgt |
11000982 |
T |
|
| Q |
119 |
cagatttcaagtccctgtgaatcaaccctagaccatgaacataagccatgcctcttgcaacatccaaagcttgtttgacagcttgtttaaggggaactgc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11000981 |
cagatttcaagtccctgtgaatcaaccctagaccatgaacataagccatgcctcttgcaacatccaaagcttgtttgacagcttgtttaaggggaactgc |
11000882 |
T |
|
| Q |
219 |
tcggttttgacgctggtttaagaactgtcgaactgatccacccttagcatactcagtaacgatgcaccagaccataggtttacggcatgcacctatg |
315 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11000881 |
tcggttttgacgttggtttaagaactgtcgaactgatccacccttagcatactcagtaacgatgcaccagaccataggtttacggcatgcacctatg |
11000785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 19 - 315
Target Start/End: Original strand, 42403521 - 42403817
Alignment:
| Q |
19 |
gttccagtctcgggagtcattccttcagtgtgcacctcaatccgagccactccaaagtcagcaattttgattgacttgtcaccaaaaatcaataggttgt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42403521 |
gttccagtctcgggagtcattccttcagtttgcacctcaatccgagctactccaaagtcggcaattttgattgacttgtcaccaaaaatcaaaaggttgt |
42403620 |
T |
|
| Q |
119 |
cagatttcaagtccctgtgaatcaaccctagaccatgaacataagccatgcctcttgcaacatccaaagcttgtttgacagcttgtttaaggggaactgc |
218 |
Q |
| |
|
| ||||||||||||||||| ||||| || |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
42403621 |
cggatttcaagtccctgtggatcaatcccagaccatgaacatatgccatgcctcttgcaacatccaaagcttgtttgacagctagtttgaggggaactga |
42403720 |
T |
|
| Q |
219 |
tcggttttgacgctggtttaagaactgtcgaactgatccacccttagcatactcagtaacgatgcaccagaccataggtttacggcatgcacctatg |
315 |
Q |
| |
|
||||||||| |||| | |||||||||| ||||| |||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42403721 |
tcggttttggcgcttggttaagaactgccgaacagatccacccttagcatactcagtaacaatgcaccacaccataggtttacggcatgcacctatg |
42403817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University