View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13833_low_4 (Length: 346)
Name: NF13833_low_4
Description: NF13833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13833_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 21 - 341
Target Start/End: Original strand, 42210008 - 42210327
Alignment:
| Q |
21 |
aactatgataatttgagttcaaaatacaaaatcaaaacatgaactataagatctcgatatgtcaatttatatcaacgattgcgtgattgtgtgaatattt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42210008 |
aactatgataatttgagttcaaaatacaaaatcaaaacatgaactataagat-----tatgccaatttatatcaacgattgcgtgattgtgtgaatattt |
42210102 |
T |
 |
| Q |
121 |
caaaaccataagctacaaactgtagatgtgttcataacatgtcctgaggtaaagcatcaatgagatgatttttcaaaatttaagaaaacattaaagtaaa |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42210103 |
caaaaccataagctacaaactgtagatgtgttcataacatgtcctgagggaaagcatcaatgagatgatttttcaaaatttaagaaaacattaaagtaaa |
42210202 |
T |
 |
| Q |
221 |
aatggtgggggttagaggatgaatcgtataattaggctaatgcaagaattctcatatc----atataaaaataaaaatggtgtcttttgtctcttctttt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42210203 |
aatggtgggggttagaggatgaatcgtataattaggctaatgcaagaattctcatatcatatatataaaaataaaaatggtgtcttttgtctcttctttt |
42210302 |
T |
 |
| Q |
317 |
gaatgttatggggtcctttgcttct |
341 |
Q |
| |
|
|||||||||||||||| ||| |||| |
|
|
| T |
42210303 |
gaatgttatggggtcccttgattct |
42210327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University