View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13833_low_5 (Length: 346)
Name: NF13833_low_5
Description: NF13833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13833_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 22 - 328
Target Start/End: Complemental strand, 43395193 - 43394891
Alignment:
| Q |
22 |
catgttcataccaaccccaccagtgaggtcataggttttctggtgagtgtccactgtcccaaaaaacatgtcattcatgaaatctgttaggtcaggtggt |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43395193 |
catgttcataccaaccccaccagtgaggtcataggttttctggtgagtgtctactgtcccaaaaaacatgtcattcatgaaatctgttaggtcaggtggt |
43395094 |
T |
|
| Q |
122 |
ggttcttccctacgtagtgtctctgccatcnnnnnnngtaggtttagtgaccctttgttctctcttcctaaccttcgctccattgatgatgagagataca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43395093 |
ggttcttccctacgtagtgtctctgccatctttttttgtaggtttagtgaccctttgttctctcttcctaaccttcgctccat---tgatgagagataca |
43394997 |
T |
|
| Q |
222 |
ctattgctgatttctctatgaggtggataaaagggatgagttttgtgttattaaaatgtaagaatggtagaagtagaaaacatagaaaggttgataacat |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43394996 |
ctattgctgatttctctatgaggtggataaaagggatgagttttgtgttattaaaatgtaagaatggtagaagtagaaaacatag-aaggttgataacat |
43394898 |
T |
|
| Q |
322 |
tgaagat |
328 |
Q |
| |
|
||||||| |
|
|
| T |
43394897 |
tgaagat |
43394891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University