View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13835_high_19 (Length: 320)
Name: NF13835_high_19
Description: NF13835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13835_high_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 72; Significance: 1e-32; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 184 - 263
Target Start/End: Original strand, 5679675 - 5679754
Alignment:
| Q |
184 |
ggtgacgactttattgttttacgagcaaccctcgatttgttttcaagaatttcaaacctgaaatttaatgccaacgacca |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
5679675 |
ggtgacgactttattgttttacgagcaaccctcgatttgttttcaagaatttcaaacctgaaatttaatgcgagcgacca |
5679754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 61 - 134
Target Start/End: Original strand, 5679551 - 5679624
Alignment:
| Q |
61 |
aatgttgtagaacgcaaatatttttcctgcacataatcaatccccgaactcgaaatcaggtttcaagaaccata |
134 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5679551 |
aatgctgtagaacgcaaatatttttcctgcacataatcaatccccgaactcgaaatcaggtttcaagaaccata |
5679624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University