View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13835_high_25 (Length: 267)
Name: NF13835_high_25
Description: NF13835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13835_high_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 23 - 252
Target Start/End: Complemental strand, 38792358 - 38792130
Alignment:
| Q |
23 |
aagttttaattaagcattacttcttgaaaatatgaattgtgtcaatgaagaatatggcaagtgctgtaatatgcaatactttgnnnnnnnntattactat |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38792358 |
aagttttaattaagcattacttcttgaaaatgttaattgtgtcaatgaagaatatggcaagtgctgtaatatgcaatactttgaaaaaaa-tattactac |
38792260 |
T |
 |
| Q |
123 |
tgccttgaacttgtgtttatccctttttgaggtttaaaattgaactgttttaagagttatttttggtttcagaattttgaggacnnnnnnnnggggtatt |
222 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || | ||| |
|
|
| T |
38792259 |
tgccttaaacctgtgtttatccctttttgaggtttaaaattgaactgttttaagagttatttttggtttcagaatttcgaggactttgttgtggagcatt |
38792160 |
T |
 |
| Q |
223 |
tcgtcagtcgtgctcatgatattatggttg |
252 |
Q |
| |
|
||||||| |||||||||||||||||||||| |
|
|
| T |
38792159 |
tcgtcagccgtgctcatgatattatggttg |
38792130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 205
Target Start/End: Complemental strand, 5838392 - 5838358
Alignment:
| Q |
171 |
tttaagagttatttttggtttcagaattttgagga |
205 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
5838392 |
tttaagtgttatttttggtttcagaattttgagga |
5838358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 67 - 104
Target Start/End: Original strand, 52474429 - 52474466
Alignment:
| Q |
67 |
atgaagaatatggcaagtgctgtaatatgcaatacttt |
104 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
52474429 |
atgaagattatggaaagtgctgtaatatgcaatacttt |
52474466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 170 - 206
Target Start/End: Complemental strand, 4519926 - 4519890
Alignment:
| Q |
170 |
ttttaagagttatttttggtttcagaattttgaggac |
206 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
4519926 |
ttttaagtgttatttttggttttagaattttgaggac |
4519890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University