View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13835_high_30 (Length: 234)
Name: NF13835_high_30
Description: NF13835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13835_high_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 10432666 - 10432454
Alignment:
| Q |
1 |
ctaattacatcatataaaatcaatttttgttgttctagaaacaaattgttggggagattttgaaaatgtaacggcacatcaaagattcaaaaactttaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10432666 |
ctaattacatcatataaaatcaatttttgttgttctagaa-caaattgttggggagattgtgaaaatgtaacggcacatcaaagattcaaaaactttaaa |
10432568 |
T |
 |
| Q |
101 |
acatggaaatataaatcactgtcttatcttatatatataatatttaaatcattaataatcgatacgaaattaactactcacatttgaactcaacaaacaa |
200 |
Q |
| |
|
||||| |||||||| ||||| ||| |||||||||||||| ||||||||||||||||| || |||||||| ||||||||||||||||| |||| |
|
|
| T |
10432567 |
acatgaaaatataagtcactatct-------catatataatatttagatcattaataatcgatatgagattaactattcacatttgaactcaacccacaa |
10432475 |
T |
 |
| Q |
201 |
taacaaatgaaataaacgtgg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
10432474 |
taacaaatgaaataaacgtgg |
10432454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University