View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13835_low_16 (Length: 398)
Name: NF13835_low_16
Description: NF13835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13835_low_16 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 362; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 362; E-Value: 0
Query Start/End: Original strand, 17 - 398
Target Start/End: Original strand, 7929048 - 7929429
Alignment:
| Q |
17 |
atgagacaggataaacagtgatatgcttcattggattagccacttcctttccaccagcatgcatcacaaactcctttggagtgaggaaactaccatggca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7929048 |
atgagacaggataaacagtgatatgcttcattggattagccacttcctttccaccagcatgcatcacaaactcctttggagtgaggaaactaccatggca |
7929147 |
T |
|
| Q |
117 |
gacacatacaatacaaacttcaccagacctatacttgtacagaaatccttctattcgcttcccatttgggccatctccagtcgttgtaacggtcggcatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7929148 |
gacacatacaatacaaacttcaccagacctatacttgtacagaaatccttctattcgcttcccatttgggccatctccagtcgttgtaacggtcggcatt |
7929247 |
T |
|
| Q |
217 |
tgtctcaatatttccatcacatcacctttaagactacagtagtcggggagagtagtcttttttgctcgattctcatgtttagtatcagcagacttaggtg |
316 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7929248 |
tgtctcaatatctccatcacatcacctttaagactgcagtagtcagggagagtagtcttttttgctcgattctcatgtttagtatcagcagacttaggtg |
7929347 |
T |
|
| Q |
317 |
gaaggggaatttccttgcctattggtttcttgaaaatcattgaattattttcacgcttggttgatatctgaaatttggaatc |
398 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7929348 |
gaaggggaatttccttgcctattggtttcttgaaaatcattgaaacattttcacgcttggttgatatctgaaatttggaatc |
7929429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University