View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13835_low_21 (Length: 320)

Name: NF13835_low_21
Description: NF13835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13835_low_21
NF13835_low_21
[»] chr6 (2 HSPs)
chr6 (184-263)||(5679675-5679754)
chr6 (61-134)||(5679551-5679624)


Alignment Details
Target: chr6 (Bit Score: 72; Significance: 1e-32; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 184 - 263
Target Start/End: Original strand, 5679675 - 5679754
Alignment:
184 ggtgacgactttattgttttacgagcaaccctcgatttgttttcaagaatttcaaacctgaaatttaatgccaacgacca 263  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||    
5679675 ggtgacgactttattgttttacgagcaaccctcgatttgttttcaagaatttcaaacctgaaatttaatgcgagcgacca 5679754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 61 - 134
Target Start/End: Original strand, 5679551 - 5679624
Alignment:
61 aatgttgtagaacgcaaatatttttcctgcacataatcaatccccgaactcgaaatcaggtttcaagaaccata 134  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5679551 aatgctgtagaacgcaaatatttttcctgcacataatcaatccccgaactcgaaatcaggtttcaagaaccata 5679624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University