View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13835_low_23 (Length: 310)
Name: NF13835_low_23
Description: NF13835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13835_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 87 - 301
Target Start/End: Original strand, 47112370 - 47112584
Alignment:
| Q |
87 |
aaatattaatattatcctaattgcctcgagacctttctctgacgtcaattgaagaattgaaccatcagtagttcataataatcatcaccatatgcttgtg |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47112370 |
aaatattaatattatcctaattgcctcgagacctttctctgacgtcaattgaagaattgaaccatcagtagttcataataatcatcaccatatgcttgtg |
47112469 |
T |
|
| Q |
187 |
agcttcattttcacatagcgcatgatgtatgtattgttgtaatttgtgattggtatgtgacagatagagaatgctcgacattggacatatagttgtaatt |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
47112470 |
agcttcattttcacatagcgcatgatgtatgtattgttgtaatttgtgattggtatgtgacagatagagcatggtcgacattgggcatatagttgtaatt |
47112569 |
T |
|
| Q |
287 |
gcgacggtgacagaa |
301 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
47112570 |
gcgacggtgacagaa |
47112584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 89
Target Start/End: Original strand, 47112259 - 47112330
Alignment:
| Q |
18 |
catatcgatcactaattttaatcaatgagaattaacatgattaagataggtaaagaaggcaactactcaaaa |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47112259 |
catatcgatcactaattttaatcaatgagaattaacatgattaagataggcaaagaaggcaactactcaaaa |
47112330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University