View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13835_low_26 (Length: 272)
Name: NF13835_low_26
Description: NF13835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13835_low_26 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 262; Significance: 1e-146; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 7 - 272
Target Start/End: Complemental strand, 7902717 - 7902452
Alignment:
| Q |
7 |
agcagaacctgtgtcattgctagctggcaactgtggaaggatgggttggacagtgtttgggatgtctttgtattgaagtatagctgtagcagttttgttg |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7902717 |
agcaaaacctgtgtcattgctagctggcaactgtggaaggatgggttggacagtgtttgggatgtctttgtattgaagtatagctgtagcagttttgttg |
7902618 |
T |
 |
| Q |
107 |
tcaacttgaattggggcatccataaaagccttggtggccacaaagtacctaccagcaacttgattggcatgaaccagaacgtttgtggtttgaccaggag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7902617 |
tcaacttgaattggggcatccataaaagccttggtggccacaaagtacctaccagcaacttgattggcatgaaccagaacgtttgtggtttgaccaggag |
7902518 |
T |
 |
| Q |
207 |
caattagtatagcctgagtggtgaatggttttgtataaacagcatcaacctccactactgtcatgt |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7902517 |
caattagtatagcctgagtggtgaatggttttgtataaacagcatcaacctccactactgtcatgt |
7902452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 182 - 272
Target Start/End: Complemental strand, 7892269 - 7892179
Alignment:
| Q |
182 |
agaacgtttgtggtttgaccaggagcaattagtatagcctgagtggtgaatggttttgtataaacagcatcaacctccactactgtcatgt |
272 |
Q |
| |
|
||||| |||||||||||||||||| ||||||| || | || || |||||||||||||| ||||| |||||||| || ||||||||||||| |
|
|
| T |
7892269 |
agaacatttgtggtttgaccaggaccaattagaatggattgtgttgtgaatggttttgtgtaaactgcatcaacttcaactactgtcatgt |
7892179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University