View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13835_low_29 (Length: 265)
Name: NF13835_low_29
Description: NF13835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13835_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 94; Significance: 6e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 70 - 247
Target Start/End: Original strand, 38792875 - 38793055
Alignment:
| Q |
70 |
ggattgtctgattacatgactgtacagtcaccgactgcactgaattcaaattcagttctgtcatagtctgcccttcggcgtggttttgacgtaatatcag |
169 |
Q |
| |
|
||||||||||| ||||||| | |||||||||| |||||||||||||||||||||||||| ||| ||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
38792875 |
ggattgtctgactacatgattatacagtcacctactgcactgaattcaaattcagttctatcacagtctgcccttcggcatggttttgacataatatcag |
38792974 |
T |
 |
| Q |
170 |
tgat--gttacgcagaggcgaaggaaaccggtcttcgcgttttacct-ggaacttgtacatacttgcttcacttttctatg |
247 |
Q |
| |
|
| || | |||| || ||| ||||||| | |||||| |||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
38792975 |
taataagctacggagcggcaaaggaaatcagtcttcacgttttacatgggaacttgtacatacttgcttcacttttctatg |
38793055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 38792377 - 38792430
Alignment:
| Q |
1 |
tgaattatgtggagaatagaaaatgttaagatttcaactacaaactaatgaaag |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||| ||||||| |
|
|
| T |
38792377 |
tgaattatgtggagaatagaaaatgttaagatgtcaactacagactgatgaaag |
38792430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 191 - 257
Target Start/End: Original strand, 29780355 - 29780422
Alignment:
| Q |
191 |
gaaaccggtcttcgcgttttacctggaacttg-tacatacttgcttcacttttctatgtatctgtgct |
257 |
Q |
| |
|
||||||||||||| |||||||| ||||||||| || ||||||||||||| ||||||||| |||||| |
|
|
| T |
29780355 |
gaaaccggtcttcacgttttacttggaacttgttagggacttgcttcacttgtctatgtatatgtgct |
29780422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University