View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13835_low_31 (Length: 237)
Name: NF13835_low_31
Description: NF13835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13835_low_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 63 - 228
Target Start/End: Original strand, 22674341 - 22674503
Alignment:
| Q |
63 |
catatttgtttaattattgacttgataattaaatatacattagatttgatgagttcatagcnnnnnnnnnnnnagaagatttgatgagttcatagttgaa |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22674341 |
catatttgtttaattattgacttgataattaaatatacattagatttgatgagttcatagcttttttttt---agaagatttgatgagttcatagttgaa |
22674437 |
T |
|
| Q |
163 |
tattgtataatcatatcatttaactatacacgcaaagttatgacaaatcaaagatttgtgatgatg |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
22674438 |
tattgtataatcatatcatttaactatacacacaaagttatgacaaatcaaagatttgtgatgatg |
22674503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 22674274 - 22674312
Alignment:
| Q |
1 |
taaaattcataaaatttgttaataaacaaatacaccata |
39 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
22674274 |
taaaattcataaaatttgttaataaacaaatataccata |
22674312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University