View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13835_low_33 (Length: 227)
Name: NF13835_low_33
Description: NF13835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13835_low_33 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 27424178 - 27423954
Alignment:
| Q |
7 |
agatttccactttcaaccaccaa----tatactgcgtaatcccaattcacacatggaacacttcaagatgagtacattgcaaagttactatatactttgt |
102 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27424178 |
agatttccactttcaaccaccaaccaatatactgtgtaatcccaattcacacatggaacacttcaagatgagtacattgcaaaattactatatactttgt |
27424079 |
T |
 |
| Q |
103 |
attaattttctagctatagctaggttattttacattggtacatcgtttctgaccctgtgggaatttagggacataatcaaactcatgcaacaaacaaact |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27424078 |
attaattttctagctatagctaggttattttacattggtacatcgtttctgaccctgtgggaatttagggacataatcaaactcatgcaacaaacaaacc |
27423979 |
T |
 |
| Q |
203 |
aaagctatggaggctaaaaatacaa |
227 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
27423978 |
aaagctatggaggctaaaaatacaa |
27423954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University