View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13836_high_23 (Length: 284)
Name: NF13836_high_23
Description: NF13836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13836_high_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 4e-56; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 159 - 277
Target Start/End: Complemental strand, 33305746 - 33305628
Alignment:
| Q |
159 |
ttacattcacattttcaccattgtctttgctgaacttatttgattttttggaaccattcttcagtaagattggatttgtcacaaattgttggaagacaca |
258 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33305746 |
ttacattcacattttcaccgttgtctttgctgaacttatttgattttttggaaccattcttcagtaagattggatttgtcacaaattgttggaagacaca |
33305647 |
T |
 |
| Q |
259 |
tatgaaatttgtgatgatg |
277 |
Q |
| |
|
|||||||||||| |||||| |
|
|
| T |
33305646 |
tatgaaatttgtaatgatg |
33305628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 17 - 124
Target Start/End: Complemental strand, 33305856 - 33305749
Alignment:
| Q |
17 |
atgttcaaactcagatnnnnnnngtaatatctttaaattcatcagtagcaagaagttcacctactagaaacatatgaaaatgctttgaatttcaagcaaa |
116 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33305856 |
atgttcaaactcagataaaaaaagtaatatcttcaaattcattagtagcaagaagttcacctactagaaacatatgaaaatgcattgaatttcaagcaaa |
33305757 |
T |
 |
| Q |
117 |
atatgcaa |
124 |
Q |
| |
|
|||||||| |
|
|
| T |
33305756 |
atatgcaa |
33305749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 148 - 221
Target Start/End: Original strand, 31540632 - 31540705
Alignment:
| Q |
148 |
atataattacattacattcacattttcaccattgtctttgctgaacttatttgattttttggaaccattcttca |
221 |
Q |
| |
|
||||| |||||||||| |||||||||||| ||||||||||||||||||| || |||| ||||||||||||||| |
|
|
| T |
31540632 |
atatagttacattacaatcacattttcacttttgtctttgctgaacttatctggttttatggaaccattcttca |
31540705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University