View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13836_high_33 (Length: 225)
Name: NF13836_high_33
Description: NF13836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13836_high_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 2 - 208
Target Start/End: Complemental strand, 43458176 - 43457970
Alignment:
| Q |
2 |
ttgaaccagggttgttcttctatcttttttgcttgatgtgaaatggtgctaatgaagcttatctttacatgattcatttcagaagaagtagcaatgcaga |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43458176 |
ttgaaccagggttgttcttctatcttttttgcttgatgtgaaatggtgctaatgaagcttatctttacatgattcatttcagaagaagtagcaatgcaga |
43458077 |
T |
|
| Q |
102 |
gaatgggtagtagagataatccaacacttgagtcagccactggagttgctccaaagagaggaatggttcttccttttcaaccacttgcaatgtcttttga |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43458076 |
gaatgggtagtagagataatccaacacttgagtcagccactggagttgctccaaagagaggaatggttcttccttttcaaccacttgcaatgtcttttga |
43457977 |
T |
|
| Q |
202 |
tagtgtt |
208 |
Q |
| |
|
||||||| |
|
|
| T |
43457976 |
tagtgtt |
43457970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 4500936 - 4500986
Alignment:
| Q |
158 |
agaggaatggttcttccttttcaaccacttgcaatgtcttttgatagtgtt |
208 |
Q |
| |
|
||||||||| |||| ||||| ||||||||||||||||| ||||| |||||| |
|
|
| T |
4500936 |
agaggaatgattctacctttccaaccacttgcaatgtcctttgagagtgtt |
4500986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University