View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13836_low_17 (Length: 334)
Name: NF13836_low_17
Description: NF13836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13836_low_17 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 12 - 334
Target Start/End: Original strand, 22361716 - 22362044
Alignment:
| Q |
12 |
caaaccctttaacaccctttgtttgaacatcttcctcctttttccctccacctcca------ggagcagcccatgttgaaggaagtattacagcttcgcg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| || |
|
|
| T |
22361716 |
caaaccctttaacaccctttgtttgaacatcttcatcctttttccctccaccaccaccaccaggagcagcccatgttgaaggaagtattacagcttcacg |
22361815 |
T |
|
| Q |
106 |
ttgagcatcgacgacgtccttcatagtgccctcactcacaccaaatgcagctgcaagttcaggtcccaaaatggtcttaagaagtgatgcagcacctgct |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22361816 |
ttgagcatcgacgacgtccttcatagtgccctcactcacaccaaatgcagctgcaagttcaggtcccaaaatggtcttaagaagtgatgcagcacctgct |
22361915 |
T |
|
| Q |
206 |
agaaactgtggatggctcttttttgatgaggttgtgaatccaaagaactctaagggtccatttcttgcagctatttgacagaaaggaaagtatcttggta |
305 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22361916 |
agaaactgtggatagctcttttttgatgaggttgtgaatccaaagaactctaagggtccatttcttgcagctatttgacagaaaggaaagtatcttggta |
22362015 |
T |
|
| Q |
306 |
tgtagaatatgtctcctactttgatttct |
334 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
22362016 |
tgtagaatatgtctcctactttgatttct |
22362044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University