View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13836_low_37 (Length: 221)
Name: NF13836_low_37
Description: NF13836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13836_low_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 37503137 - 37502936
Alignment:
| Q |
1 |
ccttcttgactcaaaatccacattttccatttgatgctcatggctccacttgattgttcacaatgatccacatggttctccttcgtccaccaaacaaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37503137 |
ccttcttgactcaaaatccacattttccatttgatggtcatggctccacttgattgctcacaatgatccacatggttctccttcgtccaccaaacaaatt |
37503038 |
T |
 |
| Q |
101 |
tggaaaaaacaattctgttttaacacgcacaaaaccactcgaatcatttctgatgcaggcaccaatgccttctccattactagcatttgaaaatgaggca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37503037 |
tggaaaaaacaattctgttttaacacgcacgaaaccactcgaatcatttctgatgcaggcaccaatgccttctccattactagcattggaaaatgaggca |
37502938 |
T |
 |
| Q |
201 |
tt |
202 |
Q |
| |
|
|| |
|
|
| T |
37502937 |
tt |
37502936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University