View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13837_low_17 (Length: 273)
Name: NF13837_low_17
Description: NF13837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13837_low_17 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 15 - 273
Target Start/End: Complemental strand, 35255693 - 35255435
Alignment:
| Q |
15 |
tattcttggactatttaacaaaaattctgtttttaattcgtttaatgtgtgtaatcaccatcaaatcattggtagttaatttaattcatagattagtgta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
35255693 |
tattcttggactatttaacaaaaattctgtttttaatttgtttaatgtgtgtaatcaccatcaaatcattggtagttaatttaattcatagattagtgga |
35255594 |
T |
 |
| Q |
115 |
aagaataactatatcgatcgcaatggtttggtgctgatttttattcttcttttttatatgtatcatttcatattaggggttagtgccgggagggttctta |
214 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35255593 |
aagaataactatatcgatcacaatggtttggtgctgatttttattcttcttttttatatgtatcatttcatattaggggttagtgccgggaggattctta |
35255494 |
T |
 |
| Q |
215 |
tgcggatattcttgcaaagtttggttcaagctgcgatgaacctcatgttatggttcatc |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35255493 |
tgcggatattcttgcaaagtttggttcaagctgcgatgaacctcatgttatggttcatc |
35255435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University