View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13837_low_21 (Length: 239)
Name: NF13837_low_21
Description: NF13837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13837_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 25 - 220
Target Start/End: Original strand, 12544968 - 12545163
Alignment:
| Q |
25 |
ggaataaaaggataattcaaaatcaagaggagaatattcaacctagctctatcatatgaatgatgagtccaaaacagaagaatagagaaacccttgccaa |
124 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
12544968 |
ggaatcaaaggataatgcaaaatcaagaggagaatattcaacctagctctatcatatgaatgatgagtccaagacagaagaatagagaaacccttgccaa |
12545067 |
T |
|
| Q |
125 |
attaggctaaatatgattgggattgacagtaactactaagaaacgaagaagtttagttaaataataacctaataaccctgtgcctaacatggcact |
220 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12545068 |
gttaggcaaaatatgattgggattgacagtaactactaagaaacgaagaagtttagttaaataataacctattaaccctgtgcctaacatggcact |
12545163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University