View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13837_low_7 (Length: 418)
Name: NF13837_low_7
Description: NF13837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13837_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 43 - 236
Target Start/End: Complemental strand, 12849429 - 12849236
Alignment:
| Q |
43 |
tagttcaaagatataaagagaacttcttaaatcagacaaagattttcaaagtaatatgaaaaagttcaaacaataaccaaccaagatataattaatatag |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12849429 |
tagttcaaagatataaagagaacttcttaaatcagacaaagattttcaaagtaccaagaaaaagttcaaacaataaccaaccaagatataattaatatag |
12849330 |
T |
 |
| Q |
143 |
tcaaaggaaaaggtgtttgggaattgaaccctttcaacnnnnnnngtctgtttcttgtctgatcagatcccaagaaaaacacaacaatgttatt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12849329 |
tcaaaggaaaaggtgtttgggaattgaaccctgtcaactttttttgtctgtttcttgtctgatcagatcccaagaaaaacacaacaatgttatt |
12849236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 343 - 406
Target Start/End: Complemental strand, 12849132 - 12849069
Alignment:
| Q |
343 |
ccctataatgatagttttctttgttttctcgcaaaaacaatctctactatttgaacatcaccta |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12849132 |
ccctataatgatagttttctttgttttctcgcaaaaacaatctcttctatttgaacatcaccta |
12849069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University