View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13838_high_15 (Length: 297)

Name: NF13838_high_15
Description: NF13838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13838_high_15
NF13838_high_15
[»] chr5 (2 HSPs)
chr5 (32-162)||(39972870-39972981)
chr5 (169-200)||(39972975-39973006)


Alignment Details
Target: chr5 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 32 - 162
Target Start/End: Original strand, 39972870 - 39972981
Alignment:
32 aagcatagggacgcaagaaaaccccctttaacctaaagcatatgtttagtgtgtgtgacttcattgcaaaactctttagaacaaaaaattataatattag 131  Q
    |||||| |||||||||||||||| ||||||||||||||||||||||||||||||                   |||||||||||||||||||||||||||    
39972870 aagcattgggacgcaagaaaacctcctttaacctaaagcatatgtttagtgtgt-------------------ctttagaacaaaaaattataatattag 39972950  T
132 tagaaaatatttacttgaccacaagtattta 162  Q
    |||||||||||||||||||||||||||||||    
39972951 tagaaaatatttacttgaccacaagtattta 39972981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 169 - 200
Target Start/End: Original strand, 39972975 - 39973006
Alignment:
169 gtatttaaacacagtcagttactcatactctt 200  Q
    ||||||||||||||||||||||||||||||||    
39972975 gtatttaaacacagtcagttactcatactctt 39973006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University