View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13838_low_15 (Length: 297)
Name: NF13838_low_15
Description: NF13838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13838_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 32 - 162
Target Start/End: Original strand, 39972870 - 39972981
Alignment:
| Q |
32 |
aagcatagggacgcaagaaaaccccctttaacctaaagcatatgtttagtgtgtgtgacttcattgcaaaactctttagaacaaaaaattataatattag |
131 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39972870 |
aagcattgggacgcaagaaaacctcctttaacctaaagcatatgtttagtgtgt-------------------ctttagaacaaaaaattataatattag |
39972950 |
T |
|
| Q |
132 |
tagaaaatatttacttgaccacaagtattta |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
39972951 |
tagaaaatatttacttgaccacaagtattta |
39972981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 169 - 200
Target Start/End: Original strand, 39972975 - 39973006
Alignment:
| Q |
169 |
gtatttaaacacagtcagttactcatactctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
39972975 |
gtatttaaacacagtcagttactcatactctt |
39973006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University